# WIA-BIO-012 — Phase 1: Data Format > Synthetic-biology canonical Phase 1: genetic-part standards + chassis descriptors. # WIA-BIO-012: Synthetic Biology Specification v1.0 > **Standard ID:** WIA-BIO-012 > **Version:** 1.0.0 > **Published:** 2025-12-26 > **Status:** Active > **Authors:** WIA Biotechnology Research Group --- ## Table of Contents 1. [Introduction](#1-introduction) 2. [Genetic Part Standards](#2-genetic-part-standards) 3. [DNA Assembly Methods](#3-dna-assembly-methods) 4. [Genetic Circuit Design](#4-genetic-circuit-design) 5. [Metabolic Engineering](#5-metabolic-engineering) 6. [Cell-Free Systems](#6-cell-free-systems) 7. [Computational Design Tools](#7-computational-design-tools) 8. [Biosafety and Biosecurity](#8-biosafety-and-biosecurity) 9. [Implementation Guidelines](#9-implementation-guidelines) 10. [References](#10-references) --- ## 1. Introduction ### 1.1 Purpose This specification defines the comprehensive framework for synthetic biology, enabling the design, construction, and optimization of engineered biological systems for beneficial applications. ### 1.2 Scope The standard covers: - Standardized genetic parts (BioBricks, MoClo, etc.) - DNA assembly protocols - Genetic circuit modeling and design - Metabolic pathway engineering - Cell-free expression systems - Biosafety and ethical guidelines ### 1.3 Philosophy **弘益人間 (Benefit All Humanity)** - This standard aims to democratize synthetic biology while ensuring responsible development that benefits humanity and protects the environment. ### 1.4 Terminology - **BioBrick**: Standardized DNA part with defined prefix/suffix sequences - **Genetic Circuit**: Network of regulatory genetic elements - **Metabolic Flux**: Rate of flow through a metabolic pathway - **Chassis Organism**: Host organism for engineered genetic systems - **Part Registry**: Repository of characterized biological parts --- ## 2. Genetic Part Standards ### 2.1 BioBrick Standard (RFC10) The BioBrick standard defines standardized DNA parts with compatible restriction sites: ``` Prefix: EcoRI - XbaI Part: [Genetic Element] Suffix: SpeI - PstI ``` Assembly format: ``` 5'-GAATTC-GCGGCCGC-T-TCTAGA-[Part]-TACTAG-AGCGGCCGC-CTGCAG-3' EcoRI NotI XbaI SpeI NotI PstI ``` ### 2.2 Part Categories #### 2.2.1 Promoters Control transcription initiation: | Part | Type | Strength | Organism | |------|------|----------|----------| | BBa_J23100 | Constitutive | 1791 RPU | E. coli | | BBa_J23119 | Constitutive | 1 RPU | E. coli | | BBa_R0011 | Inducible (LacI) | Variable | E. coli | | BBa_R0040 | Inducible (TetR) | Variable | E. coli | Strength calculation: ``` P = Pmax × f(inducer) ``` For Hill function regulation: ``` P = Pmax × [I]ⁿ / (Kd + [I]ⁿ) ``` Where: - `P` = Promoter activity (RPU) - `Pmax` = Maximum activity - `[I]` = Inducer concentration - `Kd` = Dissociation constant - `n` = Hill coefficient (cooperativity) #### 2.2.2 Ribosome Binding Sites (RBS) Control translation initiation: | Part | Type | Strength | ΔG (kcal/mol) | |------|------|----------|---------------| | BBa_B0034 | Strong | High | -12.1 | | BBa_B0032 | Medium | Medium | -9.8 | | BBa_B0033 | Weak | Low | -6.5 | Translation initiation rate: ``` TIR = K × exp(-ΔG / RT) ``` Where: - `TIR` = Translation Initiation Rate - `K` = Proportionality constant - `ΔG` = Free energy of ribosome binding - `R` = Gas constant (1.987 cal/mol·K) - `T` = Temperature (K) #### 2.2.3 Coding Sequences (CDS) Protein-coding regions: | Part | Protein | Function | Size (bp) | |------|---------|----------|-----------| | BBa_E0040 | GFP | Fluorescence | 720 | | BBa_E1010 | RFP | Fluorescence | 678 | | BBa_K082003 | Luciferase | Bioluminescence | 1653 | Codon optimization: ``` CAI = exp(Σ ln(w_i) / L) ``` Where: - `CAI` = Codon Adaptation Index - `w_i` = Relative adaptiveness of codon i - `L` = Number of codons #### 2.2.4 Terminators Stop transcription: | Part | Type | Efficiency | |------|------|------------| | BBa_B0015 | Double | >95% | | BBa_B0010 | Single | ~85% | Termination efficiency: ``` η = (T_background - T_part) / T_background ``` Where: - `η` = Termination efficiency - `T_background` = Background transcription - `T_part` = Transcription with terminator ### 2.3 MoClo (Modular Cloning) Standard Hierarchical assembly using Type IIS restriction enzymes: ``` Level 0: Individual parts Level 1: Transcription units (promoter-RBS-CDS-terminator) Level 2: Multi-gene constructs Level 3+: Complex assemblies ``` Golden Gate reaction: ``` BsaI/BpiI digestion + T4 ligase 37°C (digestion) / 16°C (ligation) cycles ``` --- --- ## A.1 Genetic-part envelope (canonical) The canonical genetic-part envelope carries: part identifier (BBa- or registry-local prefix), part type (promoter, RBS, CDS, terminator, regulatory, composite), DNA sequence, prefix/suffix specification (BioBrick RFC10 / RFC25 / RFC1000 compliance), characterisation context (chassis, medium, induction), and the responsible-use licensing block. Parts conforming to multiple assembly standards declare each conformance separately so downstream tooling can select the right assembly path. ## A.2 BioBrick (RFC10) prefix and suffix RFC10 BioBricks carry the canonical 22-bp prefix `GAATTCGCGGCCGCTTCTAG` and 21-bp suffix `TACTAGTAGCGGCCGCTGCAG`, with EcoRI/XbaI/SpeI/PstI restriction sites. The prefix immediately precedes the part body; the suffix immediately follows. Part bodies MUST NOT contain internal occurrences of the four canonical sites; sequence-scrubbing tooling is part of the validation pipeline. ## A.3 MoClo (RFC1000) overhang specification MoClo Type IIS assembly uses BsaI / BsmBI-mediated digestion to expose 4-bp overhangs with defined identity per part position. Position 1 (left fusion) overhangs follow the canonical MoClo Level 0 conventions; the registry stores the overhang per part so downstream MoClo planning is trivially correct. Each genetic part declaration MUST list its position-class so that mis-ordered Level 1 builds can be flagged before synthesis. ## A.4 Chassis organism descriptor Chassis descriptors carry the species (E. coli K-12 MG1655, BL21(DE3), W3110; B. subtilis 168; S. cerevisiae BY4741, CEN.PK; Y. lipolytica; mammalian HEK-293, CHO; cell-free PURE, S30 lysate), the growth medium, the temperature, the induction profile, and the safety classification (BSL-1, BSL-2, BSL-3, BSL-4 per WHO LBM4). ## A.5 Sequence-format and digital-twin descriptor Genetic parts are stored in SBOL 3.x with cross-references to GenBank flat files. Digital twin descriptors capture the kinetic-parameter envelope (transcription rate, translation rate, plasmid copy number, mRNA half-life, protein half-life, degradation rate) so simulation tooling consumes the same canonical record without independent re-entry of values. ## A.6 Promoter-strength characterisation Promoter strength is measured in Relative Promoter Units (RPU) anchored to a reference promoter (typically BBa_J23101). The characterisation envelope carries: chassis, medium, induction state, fluorescence-protein reporter, plate-reader OD-normalisation pipeline, and the computed RPU. The envelope is published with raw fluorescence vs. OD time series so downstream consumers can re-derive the RPU under their own normalisation. ## A.7 RBS strength and Shine-Dalgarno Ribosome-binding-site (RBS) strength descriptors carry: Shine-Dalgarno consensus distance to the start codon, predicted translation-initiation rate (Salis-lab RBS Calculator output or equivalent), and the chassis the prediction is calibrated for. Implementations MUST list the calibration model used so downstream tools can reconcile divergent predictions across calculators. ## A.8 Cell-free reaction descriptor Cell-free reaction descriptors carry the lysate type (E. coli S30, PURE, wheat germ, rabbit reticulocyte), the energy-regeneration mix (creatine phosphate-creatine kinase, 3-PGA-pyruvate kinase, glucose-hexokinase), the magnesium and potassium concentrations, the polyethylene-glycol crowding agent concentration, the dialysis-vs-batch flag, and the temperature profile. The reactor descriptor (volumetric, pin, microfluidic continuous flow) is part of the same envelope. ## A.9 Genetic-circuit motif catalogue Standard motifs the registry recognises: toggle switch, repressilator (3-element negative-feedback ring), feed-forward loop (coherent and incoherent), pulse generator, oscillator, band-pass filter, AND/OR/NAND/NOR logic gates, fold-change detector, and integrator. Each motif carries a canonical SBOL design plus example characterisation data so users can pick a starting circuit instead of designing from scratch. ## A.10 Strain-engineering descriptor Strain-engineering descriptors capture: parental strain (lineage to a reference genome), genomic modifications (insertions, deletions, point mutations) with chromosomal coordinates, plasmid load, antibiotic-resistance markers, and auxotrophic requirements. Descriptors include a verification block (whole-genome sequencing reference, copy-number qPCR, phenotypic confirmation) so downstream consumers can audit the strain claims. ## A.11 CRISPR-Cas editing descriptor CRISPR-Cas-mediated edits carry: Cas variant (Cas9 SpCas9 / SaCas9 / Cas12a Cpf1 / Cas13 RNA-targeting / base editor / prime editor), target site (chromosomal coordinates, strand), guide-RNA sequence, predicted off-targets (with predicted scoring tool reference), repair template (HDR-donor sequence) where applicable, and the verification panel that confirmed the edit. Editing events are recorded as first-class envelopes so the strain history is fully auditable. --- ## Z.1 Glossary, conformance, governance A companion glossary at `https://wiastandards.com/synthetic-biology/glossary/` expands every term used throughout this Phase. The conformance test suite at `https://github.com/WIA-Official/wia-synthetic-biology-conformance` walks every endpoint and protocol exchange. The reference container at `wia/synthetic-biology-host:1.0.0` ships every synthetic-biology envelope and endpoint with mock data so integrators can exercise the contract before wiring real backends. The companion CLI at `cli/synthetic-biology.sh` ships sample envelope generators with no dependencies beyond `jq` and POSIX shell. ## Z.2 Cross-standard composition (recap) This Phase composes with WIA-OMNI-API for credential storage, WIA-AIR-SHIELD for runtime trust list, WIA-SOCIAL Phase 3 §5 for federation handshake, WIA-INTENT for workload intent declaration, and (where personal data is processed) WIA Secure Enclave for sealed-data envelopes. The composition lets one host running multiple WIA family standards reuse one identity, one signing key chain, and one audit transport rather than maintaining N parallel implementations. ## Z.3 Implementation runbook A first implementation typically follows: stand up the reference container; run the conformance suite against it end-to-end; replace the mock backend with a real backend one endpoint at a time; wire audit-log replication out to the operations sink; onboard a single trusted peer for federation; expand to multiple peers; promote to production with the warning-envelope subscription enabled and the runbook in §Z.5 followed. ## Z.4 Backwards-compatibility promise Within the 1.x line, every Phase 1 envelope shape, every Phase 2 endpoint, and every Phase 3 protocol exchange MUST remain reachable and MUST continue to honour the documented status codes and content shapes. Hosts MAY add optional fields and new envelopes; hosts MUST NOT remove existing ones. Breaking changes ride a major version bump with a 12-month deprecation window per IETF RFC 8594 and 9745 and require a two-thirds Committee vote. ## Z.5 Closing implementer note This Phase fits inside the WIA Standards four-Phase architecture: Phase 1 envelopes are the wire-format contract; Phase 2 surfaces them through HTTPS; Phase 3 wraps them in protocol exchanges that cross trust boundaries; Phase 4 integrates with the broader ecosystem. Synthetic-biology deployments that follow this layering inherit the per-Phase conformance gates and the cross-standard composition behaviour described in Z.2. 弘益人間 — Benefit All Humanity.